Stem-loop sequence stu-MIR408a

AccessionMI0025985 (change log)
DescriptionSolanum tuberosum miR408a stem-loop
Gene family MIPF0000102; MIR408
Literature search

5 open access papers mention stu-MIR408a
(12 sentences)

Stem-loop
   --a      c     a c     ag   ua     u 
5'    caggga gaggc g gcaug  aug  caauu u
      |||||| ||||| | |||||  |||  ||||| a
3'    gucccu cuccg c cguac  uac  guuga c
   uug      u     a a     cu   cc     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138061.1: 680411-680483 [+]
intergenic
Database links

Mature sequence stu-miR408a-5p

Accession MIMAT0031337
Sequence

1 - 

acagggacgaggcagcgcaug

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR408a-3p

Accession MIMAT0031338
Sequence

53 - 

ugcacagccucuucccugguu

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).