Stem-loop sequence stu-MIR396

AccessionMI0025984 (change log)
DescriptionSolanum tuberosum miR396 stem-loop
Gene family MIPF0000047; MIR396
Literature search

4 open access papers mention stu-MIR396
(6 sentences)

Stem-loop
   --                a    cu  -uu   ---   u   g     u    u 
5'   uuccacagcuuucuug acuu  uc   gcu   aaa uuu aucuc aaau g
     |||||||||||||||| ||||  ||   |||   ||| ||| ||||| |||| a
3'   agggugucgaaagaac ugaa  ag   cga   uuu aaa uagag uuua u
   aa                c    --  uau   agu   u   g     u    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138058.1: 516359-516463 [+]
intergenic
Database links

Mature sequence stu-miR396-5p

Accession MIMAT0031335
Sequence

1 - 

uuccacagcuuucuugaacuu

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR396-3p

Accession MIMAT0031336
Sequence

85 - 

guccaagaaagcugugggaaa

 - 105

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).