Stem-loop sequence stu-MIR398b

AccessionMI0025983 (change log)
DescriptionSolanum tuberosum miR398b stem-loop
Gene family MIPF0000107; MIR398
Literature search

4 open access papers mention stu-MIR398b
(4 sentences)

Stem-loop
   --ga   u    u                    -    cuc 
5'     gug gccu agaacacagguguauuuugg ucua   c
       ||| |||| |||||||||||||||||||| ||||   u
3'     cac ugga ucuuguguucguauaaaacc aggu   g
   uccc   -    c                    c    uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138056.1: 472688-472768 [-]
intergenic
Database links

Mature sequence stu-miR398b-5p

Accession MIMAT0031333
Sequence

1 - 

gagugugccuuagaacacaggu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR398b-3p

Accession MIMAT0031334
Sequence

61 - 

uuguguucucaggucaccccu

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).