Stem-loop sequence stu-MIR399m

AccessionMI0025975 (change log)
DescriptionSolanum tuberosum miR399m stem-loop
Gene family MIPF0000015; MIR399
Literature search

4 open access papers mention stu-MIR399m
(15 sentences)

Stem-loop
   --    ua      a     a  -  u   ua 
5'   gggc  cucucu uuggc ug ca uug  u
     ||||  |||||| ||||| || || |||  a
3'   cccg  gagagg aaccg ac gu gac  u
   gu    uc      a     c  a  c   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137943.1: 1343553-1343616 [-]
intergenic
Clustered miRNAs
< 10kb from stu-MIR399m
stu-MIR399dJH137943.1: 1350997-1351060 [+]
stu-MIR399fJH137943.1: 1348794-1348857 [-]
stu-MIR399cJH137943.1: 1345907-1345970 [+]
stu-MIR399mJH137943.1: 1343553-1343616 [-]
stu-MIR399lJH137943.1: 1337176-1337239 [-]
Database links

Mature sequence stu-miR399m-5p

Accession MIMAT0031318
Sequence

1 - 

gggcuacucucuauuggcaug

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR399m-3p

Accession MIMAT0031319
Sequence

44 - 

cgccaaaggagagcugcccug

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).