Stem-loop sequence stu-MIR167b

AccessionMI0025968 (change log)
DescriptionSolanum tuberosum miR167b stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

4 open access papers mention stu-MIR167b
(9 sentences)

Stem-loop
   --   a       g        aaa       au     
5'   uga gcugcca caugaucu   cuuuucu  ugcu 
     ||| ||||||| ||||||||   |||||||  ||| c
3'   acu cgacggu guacuaga   gaaagga  augu 
   cc   a       -        cua       gc     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137901.1: 1256041-1256114 [+]
intergenic
Clustered miRNAs
< 10kb from stu-MIR167b
stu-MIR167cJH137901.1: 1246472-1246560 [+]
stu-MIR167bJH137901.1: 1256041-1256114 [+]
Database links

Mature sequence stu-miR167b-5p

Accession MIMAT0031305
Sequence

1 - 

ugaagcugccagcaugaucua

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR167b-3p

Accession MIMAT0031306
Sequence

55 - 

gaucauguggcagcaucacc

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).