Stem-loop sequence stu-MIR167c

AccessionMI0025967 (change log)
DescriptionSolanum tuberosum miR167c stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

3 open access papers mention stu-MIR167c
(7 sentences)

Stem-loop
   --   a    -  -            a     cca       aaag 
5'   uga gcug cc agcaugaucuaa cuugg   cacuuau    a
     ||| |||| || |||||||||||| |||||   |||||||    a
3'   acu cgac gg ucguacuggauu gaauc   gugggua    a
   uc   c    a  c            g     --a       aaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137901.1: 1246472-1246560 [+]
intergenic
Clustered miRNAs
< 10kb from stu-MIR167c
stu-MIR167cJH137901.1: 1246472-1246560 [+]
stu-MIR167bJH137901.1: 1256041-1256114 [+]
Database links

Mature sequence stu-miR167c-5p

Accession MIMAT0031303
Sequence

1 - 

ugaagcugccagcaugaucua

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR167c-3p

Accession MIMAT0031304
Sequence

67 - 

ggucaugcucggacagccucacu

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).