Stem-loop sequence stu-MIR171d

AccessionMI0025966 (change log)
DescriptionSolanum tuberosum miR171d stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

7 open access papers mention stu-MIR171d
(36 sentences)

Stem-loop
   --a        ug             a   acac    uua 
5'    gauauugg  cgguucaauuaga agc    uucu   u
      ||||||||  ||||||||||||| |||    ||||    
3'    cuauaacc  gccgaguuaauuu uug    aaga   a
   gca        gu             a   cuuc    uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137887.1: 1016160-1016241 [-]
intergenic
Database links

Mature sequence stu-miR171d-5p

Accession MIMAT0031301
Sequence

1 - 

agauauuggugcgguucaauu

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR171d-3p

Accession MIMAT0031302
Sequence

62 - 

uugagccgugccaauaucacg

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).