Stem-loop sequence stu-MIR156d

AccessionMI0025965 (change log)
DescriptionSolanum tuberosum miR156d stem-loop
Gene family MIPF0000008; MIR156
Literature search

10 open access papers mention stu-MIR156d
(24 sentences)

Stem-loop
   --u         -           u     --   u     aauuuca 
5'    ugacagaag auagagagcac aauga  uga augcu       u
      ||||||||| ||||||||||| |||||  ||| |||||        
3'    acugucuuc uaucucucgug uuacu  acu uacga       u
   acu         g           u     uc   c     aaacgac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138336.1: 107387-107479 [+]
intergenic
Database links

Mature sequence stu-miR156d-5p

Accession MIMAT0031299
Sequence

1 - 

uugacagaagauagagagcac

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR156d-3p

Accession MIMAT0031300
Sequence

72 - 

gcucucuaugcuucugucauca

 - 93

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).