Stem-loop sequence stu-MIR156c

AccessionMI0025964 (change log)
DescriptionSolanum tuberosum miR156c stem-loop
Gene family MIPF0000008; MIR156
Literature search

9 open access papers mention stu-MIR156c
(22 sentences)

Stem-loop
   --u          -             u   gg   c  c 
5'    ugacagaaga uagagagcacgaa aau  aag ug a
      |||||||||| ||||||||||||| |||  ||| ||  
3'    acugucuucu aucucucguguuu uua  uuc ac u
   acu          u             c   -a   c  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138045.1: 664569-664646 [-]
intergenic
Database links

Mature sequence stu-miR156c

Accession MIMAT0031298
Sequence

1 - 

uugacagaagauagagagcac

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).