Stem-loop sequence stu-MIR156b

AccessionMI0025963 (change log)
DescriptionSolanum tuberosum miR156b stem-loop
Gene family MIPF0000008; MIR156
Literature search

9 open access papers mention stu-MIR156b
(22 sentences)

Stem-loop
   --u          -             u  u    -      aa 
5'    ugacagaaga uagagagcacaaa ga uaag ugcaug  a
      |||||||||| ||||||||||||| || |||| ||||||  a
3'    acugucuucu auuucucguguuu cu auuc acguau  u
   acc          u             c  c    c      gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137878.1: 425005-425091 [-]
intergenic
Clustered miRNAs
< 10kb from stu-MIR156b
stu-MIR156aJH137878.1: 427242-427328 [-]
stu-MIR156bJH137878.1: 425005-425091 [-]
Database links

Mature sequence stu-miR156b

Accession MIMAT0031297
Sequence

1 - 

uugacagaagauagagagcac

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).