Stem-loop sequence stu-MIR172e

AccessionMI0025961 (change log)
DescriptionSolanum tuberosum miR172e stem-loop
Gene family MIPF0000035; MIR172
Literature search

10 open access papers mention stu-MIR172e
(50 sentences)

Stem-loop
   --   a              a   ---a   u   -            --------     aa  aaa 
5'   gca caucaucaagauuc cau    aaa aga aauaauguggag        uagaa  aa   u
     ||| |||||||||||||| |||    ||| ||| ||||||||||||        |||||  ||    
3'   cgu guaguaguucuaag gua    uuu uuu uuauuauaccuc        aucuu  uu   a
   ua   c              a   aaag   u   a            uguauuaa     cg  gaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138154.1: 115358-115481 [-]
intergenic
Database links

Mature sequence stu-miR172e-5p

Accession MIMAT0031294
Sequence

1 - 

gcaacaucaucaagauucaca

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR172e-3p

Accession MIMAT0031295
Sequence

104 - 

agaaucuugaugaugcugcau

 - 124

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).