Stem-loop sequence stu-MIR172d

AccessionMI0025960 (change log)
DescriptionSolanum tuberosum miR172d stem-loop
Gene family MIPF0000035; MIR172
Literature search

10 open access papers mention stu-MIR172d
(50 sentences)

Stem-loop
   -- g                --     gcuauau           ua 
5'   g agcaucaucaagauuc  acaua       uagggcuuuua  a
     | ||||||||||||||||  |||||       |||||||||||  u
3'   c ucguaguaguucuaag  ugugu       aucccgaaaau  u
   ga g                gg     -agcagu           uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137992.1: 672078-672169 [+]
intergenic
Database links

Mature sequence stu-miR172d-5p

Accession MIMAT0031292
Sequence

1 - 

ggagcaucaucaagauucaca

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR172d-3p

Accession MIMAT0031293
Sequence

72 - 

ggaaucuugaugaugcugcag

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).