Stem-loop sequence stu-MIR172a

AccessionMI0025959 (change log)
DescriptionSolanum tuberosum miR172a stem-loop
Gene family MIPF0000035; MIR172
Literature search

12 open access papers mention stu-MIR172a
(52 sentences)

Stem-loop
   --       a          a      aag  g     ---uu     a     g 
5'   guagcau aucaagauuc caugaa   uu caaau     guuau uaauu a
     ||||||| |||||||||| ||||||   || |||||     ||||| ||||| u
3'   cgucgua uaguucuaag guacuu   aa guuua     cggua auuaa g
   ua       g          a      --a  -     ucgau     -     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137880.1: 29806-29909 [-]
intergenic
Database links

Mature sequence stu-miR172a-5p

Accession MIMAT0031290
Sequence

1 - 

guagcauaaucaagauucaca

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR172a-3p

Accession MIMAT0031291
Sequence

84 - 

agaaucuugaugaugcugcau

 - 104

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).