Stem-loop sequence stu-MIR172b

AccessionMI0025957 (change log)
DescriptionSolanum tuberosum miR172b stem-loop
Gene family MIPF0000035; MIR172
Literature search

10 open access papers mention stu-MIR172b
(50 sentences)

Stem-loop
   --      c           a   -----a      a   a -   gaa 
5'   gcagca caucaagauuc cau      gaaaau ugg c uau   a
     |||||| ||||||||||| |||      |||||| ||| | |||    
3'   cgucgu guaguucuaag gua      uuuuua acc g aua   u
   ua      a           a   cauaag      -   c u   aag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137863.1: 779979-780069 [-]
intergenic
Database links

Mature sequence stu-miR172b-5p

Accession MIMAT0031286
Sequence

1 - 

gcagcaccaucaagauucaca

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR172b-3p

Accession MIMAT0031287
Sequence

71 - 

agaaucuugaugaugcugcau

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).