Stem-loop sequence stu-MIR399i

AccessionMI0025938 (change log)
DescriptionSolanum tuberosum miR399i stem-loop
Gene family MIPF0000015; MIR399
Literature search

4 open access papers mention stu-MIR399i
(12 sentences)

Stem-loop
   --    u  a    a        -      ----u      -----g   cu 
5'   gggc ac cucu uuggcaug cagcuu     uuuggu      gcu  a
     |||| || |||| |||||||| ||||||     ||||||      |||   
3'   cccg ug gagg aaccguau gucgag     aaacua      cga  a
   au    u  a    a        a      uuuau      guuuaa   ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138739.1: 10330-10423 [+]
intergenic
Database links

Mature sequence stu-miR399i-5p

Accession MIMAT0031260
Sequence

1 - 

gggcuacacucuauuggcaug

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR399i-3p

Accession MIMAT0031261
Sequence

74 - 

ugccaaaggagaguugcccua

 - 94

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).