Stem-loop sequence stu-MIR171a

AccessionMI0025936 (change log)
DescriptionSolanum tuberosum miR171a stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

8 open access papers mention stu-MIR171a
(38 sentences)

Stem-loop
   --       c       c      aac     -      a    u 
5'   uauuggc ugguuca ucagac   aaaau gaaacu uauu a
     ||||||| ||||||| ||||||   ||||| |||||| |||| a
3'   auaaccg gccgagu aguuug   uuuug cuuuga gugg a
   cu       u       u      -cc     u      g    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137810.1: 1766224-1766312 [+]
intergenic
Database links

Mature sequence stu-miR171a-5p

Accession MIMAT0031256
Sequence

1 - 

uauuggccugguucacucaga

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR171a-3p

Accession MIMAT0031257
Sequence

69 - 

ugauugagccgugccaauauc

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).