Stem-loop sequence stu-MIR166d

AccessionMI0025935 (change log)
DescriptionSolanum tuberosum miR166d stem-loop
Gene family MIPF0000004; MIR166
Literature search

7 open access papers mention stu-MIR166d
(19 sentences)

Stem-loop
   --a     uc               -      aagaa g 
5'    gaaug  gucugguucgagauc uuucau     g u
      |||||  ||||||||||||||| ||||||     |  
3'    cuuac  cggaccaggcuuuag agagua     c a
   ccc     uu               u      acgua a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138443.1: 48077-48153 [-]
intergenic
Database links

Mature sequence stu-miR166d-5p

Accession MIMAT0031254
Sequence

1 - 

agaaugucgucugguucgaga

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR166d-3p

Accession MIMAT0031255
Sequence

57 - 

ucggaccaggcuucauucccc

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).