Stem-loop sequence stu-MIR166c

AccessionMI0025934 (change log)
DescriptionSolanum tuberosum miR166c stem-loop
Gene family MIPF0000004; MIR166
Literature search

7 open access papers mention stu-MIR166c
(29 sentences)

Stem-loop
   --      uu      cu   g c   c   uucaucuaau 
5'   ggaaug  guuugg  cga g cac aac          g
     ||||||  ||||||  ||| | ||| |||          u
3'   ccuuac  cggacc  gcu c gug uug          a
   cc      uu      ag   g u   a   uucucaacga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137934.1: 464574-464656 [+]
intergenic
Database links

Mature sequence stu-miR166c-5p

Accession MIMAT0031252
Sequence

1 - 

ggaauguuguuuggcucgagg

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR166c-3p

Accession MIMAT0031253
Sequence

63 - 

ucggaccaggcuucauucccc

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).