Stem-loop sequence stu-MIR166b

AccessionMI0025933 (change log)
DescriptionSolanum tuberosum miR166b stem-loop
Gene family MIPF0000004; MIR166
Literature search

6 open access papers mention stu-MIR166b
(16 sentences)

Stem-loop
   --      uu                     caa   -aaa   ca 
5'   ggaaug  guuugguucgaaaucauucaa   auu    guc  u
     ||||||  |||||||||||||||||||||   |||    |||   
3'   ccuuac  cggaccaggcuuuaguaaguu   uaa    uag  c
   cu      uu                     aag   cuag   cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137916.1: 535831-535921 [-]
intergenic
Database links

Mature sequence stu-miR166b

Accession MIMAT0031251
Sequence

71 - 

ucggaccaggcuucauuccuc

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).