Stem-loop sequence stu-MIR166a

AccessionMI0025932 (change log)
DescriptionSolanum tuberosum miR166a stem-loop
Gene family MIPF0000004; MIR166
Literature search

6 open access papers mention stu-MIR166a
(16 sentences)

Stem-loop
   --      uu      cu   g  -a     uucuu     cuca          ua 
5'   ggaaug  gucugg  cga ga  ucaaa     uauua    uagaucugua  u
     ||||||  ||||||  ||| ||  |||||     |||||    ||||||||||  u
3'   ccuuac  cggacc  gcu cu  aguuu     guaau    aucuagauau  g
   cc      uu      ag   g  gc     ---uu     ----          uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137800.1: 3902789-3902895 [+]
intergenic
Database links

Mature sequence stu-miR166a-5p

Accession MIMAT0031249
Sequence

1 - 

ggaauguugucuggcucgagg

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR166a-3p

Accession MIMAT0031250
Sequence

87 - 

ucggaccaggcuucauucccc

 - 107

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).