Stem-loop sequence stu-MIR171b

AccessionMI0025931 (change log)
DescriptionSolanum tuberosum miR171b stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

6 open access papers mention stu-MIR171b
(31 sentences)

Stem-loop
   --                     ug   --          aua 
5'   agauauugauguggcucaauc  aag  acauggcuaa   u
     |||||||||||||||||||||  |||  ||||||||||    
3'   ucuauaacugcgccgaguuag  uuu  uguaccgauu   g
   uc                     gu   ag          aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138432.1: 116543-116626 [+]
intergenic
Database links

Mature sequence stu-miR171b-5p

Accession MIMAT0031247
Sequence

1 - 

agauauugauguggcucaauc

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR171b-3p

Accession MIMAT0031248
Sequence

64 - 

uugagccgcgucaauaucucu

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).