Stem-loop sequence stu-MIR3627

AccessionMI0025930 (change log)
DescriptionSolanum tuberosum miR3627 stem-loop
Literature search

1 open access papers mention stu-MIR3627
(1 sentences)

Stem-loop
   --   c    g   u         --ca    u    auu   a 
5'   ucg agga aga ggcacuuag    uucc uuua   ggu a
     ||| |||| ||| |||||||||    |||| ||||   ||| a
3'   agc uucu ucu ccgugaauu    aagg aaau   ccg a
   ac   u    g   -         aacc    u    ---   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137794.1: 2388118-2388200 [-]
intergenic
Database links

Mature sequence stu-miR3627-5p

Accession MIMAT0031245
Sequence

1 - 

ucgcaggagagauggcacuuag

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR3627-3p

Accession MIMAT0031246
Sequence

63 - 

aagugccucugucuuucgaca

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).