Stem-loop sequence stu-MIR399g

AccessionMI0025879 (change log)
DescriptionSolanum tuberosum miR399g stem-loop
Gene family MIPF0000015; MIR399
Literature search

4 open access papers mention stu-MIR399g
(12 sentences)

Stem-loop
   --    ua      a     a  -     ----  u 
5'   gggc  cucucu uuggc ug caguu    ug c
     ||||  |||||| ||||| || |||||    || a
3'   cccg  gagggg aaccg ac gucga    ac c
   au    uc      a     c  a     cuuu  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137943.1: 1312547-1312614 [-]
intergenic
Clustered miRNAs
< 10kb from stu-MIR399g
stu-MIR399aJH137943.1: 1321860-1321923 [+]
stu-MIR399gJH137943.1: 1312547-1312614 [-]
Database links

Mature sequence stu-miR399g-5p

Accession MIMAT0030970
Sequence

1 - 

gggcuacucucuauuggcaug

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR399g-3p

Accession MIMAT0031233
Sequence

48 - 

cgccaaaggggagcugcccua

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).