Stem-loop sequence stu-MIR399b

AccessionMI0025874 (change log)
DescriptionSolanum tuberosum miR399b stem-loop
Gene family MIPF0000015; MIR399
Literature search

4 open access papers mention stu-MIR399b
(14 sentences)

Stem-loop
   --    ua      a        -  -    ua 
5'   gggc  cucucu uuggcaug ca cuua  u
     ||||  |||||| |||||||| || ||||   
3'   cccg  gagagg aaccguac gu gaau  a
   gu    uc      a        a  c    uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137943.1: 1330373-1330436 [+]
intergenic
Clustered miRNAs
< 10kb from stu-MIR399b
stu-MIR399aJH137943.1: 1321860-1321923 [+]
stu-MIR399kJH137943.1: 1326953-1327016 [-]
stu-MIR399bJH137943.1: 1330373-1330436 [+]
stu-MIR399nJH137943.1: 1332990-1333053 [-]
stu-MIR399lJH137943.1: 1337176-1337239 [-]
Database links

Mature sequence stu-miR399b-5p

Accession MIMAT0030965
Sequence

1 - 

gggcuacucucuauuggcaug

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR399b-3p

Accession MIMAT0031228
Sequence

44 - 

ugccaaaggagagcugcccug

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).