Stem-loop sequence stu-MIR399a

AccessionMI0025873 (change log)
DescriptionSolanum tuberosum miR399a stem-loop
Gene family MIPF0000015; MIR399
Literature search

4 open access papers mention stu-MIR399a
(14 sentences)

Stem-loop
   --    ua      a        -    gauc 
5'   gggc  cucucu uuggcaug cagu    u
     ||||  |||||| |||||||| ||||    a
3'   cccg  gagagg aaccguac gucg    u
   gu    uc      a        a    aauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137943.1: 1321860-1321923 [+]
intergenic
Clustered miRNAs
< 10kb from stu-MIR399a
stu-MIR399gJH137943.1: 1312547-1312614 [-]
stu-MIR399aJH137943.1: 1321860-1321923 [+]
stu-MIR399kJH137943.1: 1326953-1327016 [-]
stu-MIR399bJH137943.1: 1330373-1330436 [+]
Database links

Mature sequence stu-miR399a-5p

Accession MIMAT0030964
Sequence

1 - 

gggcuacucucuauuggcaug

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR399a-3p

Accession MIMAT0031227
Sequence

44 - 

ugccaaaggagagcugcccug

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).