Stem-loop sequence stu-MIR8007b

AccessionMI0025820 (change log)
DescriptionSolanum tuberosum miR8007b stem-loop
Gene family MIPF0001839; MIR8007
Literature search

2 open access papers mention stu-MIR8007b
(2 sentences)

Stem-loop
   --     ac        aa        u       a  c  uc        ua     -     -ac      uuaau     gug   uu    --c     guacuu      u 
5'   augug  acuuuuug  uuucgaga ucaaaca gu ua  uuugaccg  aauuu uucau   aucuuu     auuuu   uug  guga   uuaua      uuuaug a
     |||||  ||||||||  |||||||| ||||||| || ||  ||||||||  ||||| |||||   ||||||     |||||   |||  ||||   |||||      |||||| g
3'   uacac  ugaaaagu  aaagcucu aguuugu ca au  aaacuggc  uuaaa gggua   uagaaa     uaaaa   aac  uacu   aauau      aaauau u
   aa     ca        aa        c       -  a  uc        ua     u     cau      ----u     --a   uu    uua     ----au      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138003.1: 403573-403790 [+]
intergenic
Database links

Mature sequence stu-miR8007b-5p

Accession MIMAT0030911
Sequence

1 - 

augugacacuuuuugaauuucgag

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR8007b-3p

Accession MIMAT0031197
Sequence

195 - 

cgaaaaaugaaaaguaccacauaa

 - 218

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).