Stem-loop sequence stu-MIR8011a

AccessionMI0025816 (change log)
DescriptionSolanum tuberosum miR8011a stem-loop
Literature search

2 open access papers mention stu-MIR8011a
(7 sentences)

Stem-loop
   --                            agca a c        ucu 
5'   uugugugagguuucuuuuuguuucacaa    g g gacccaaa   u
     ||||||||||||||||||||||||||||    | | ||||||||    
3'   aacacacuccgaagaaaaauaaaguguu    c c cuggguuu   c
   uc                            caac a -        cuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137959.1: 709134-709230 [+]
intergenic
Clustered miRNAs
< 10kb from stu-MIR8011a
stu-MIR8011aJH137959.1: 709134-709230 [+]
stu-MIR6026JH137959.1: 711491-711732 [+]
Database links

Mature sequence stu-miR8011a-5p

Accession MIMAT0031195
Sequence

1 - 

uugugugagguuucuuuuuguuuc

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR8011a-3p

Accession MIMAT0030907
Sequence

74 - 

aauaaaaagaagccucacacaacu

 - 97

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).