Stem-loop sequence stu-MIR8007a

AccessionMI0025808 (change log)
DescriptionSolanum tuberosum miR8007a stem-loop
Gene family MIPF0001839; MIR8007
Literature search

3 open access papers mention stu-MIR8007a
(4 sentences)

Stem-loop
   --               ga        u       a  c   c    a   u      -uu   a  -ucuu    -aca       u  -----uca               a   c 
5'   auguggcacuuuucg  uuuugaga uuaaaca gu uaa uuug cug aaauuu   cau ga     uuaa    uuuugaa ua        auauuugugaauuau gua u
     |||||||||||||||  |||||||| ||||||| || ||| |||| ||| ||||||   ||| ||     ||||    ||||||| ||        ||||||||||||||| ||| u
3'   uacaccgugaaaagu  aaagcucu aguuugu ca auu aaac gau uuuaaa   gua cu     aguu    aaaacuu au        uauaaacauuugaug cau u
   aa               aa        c       -  a   c    c   c      ugc   -  uuacu    aaaa       u  uuuaaaca               -   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137932.1: 818593-818818 [+]
intergenic
Database links

Mature sequence stu-miR8007a-5p

Accession MIMAT0030899
Sequence

1 - 

auguggcacuuuucggauuuugag

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR8007a-3p

Accession MIMAT0031193
Sequence

203 - 

cgaaaaaugaaaagugccacauaa

 - 226

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).