Stem-loop sequence stu-MIR7983

AccessionMI0025760 (change log)
DescriptionSolanum tuberosum miR7983 stem-loop
Literature search

1 open access papers mention stu-MIR7983
(1 sentences)

Stem-loop
   --           g  a        cuaau 
5'   uaaagucuuua cg cauugguu     g
     ||||||||||| || ||||||||      
3'   auuucagaaau gc guaaucaa     g
   ca           g  c        uucac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138561.1: 39265-39324 [-]
intergenic
Database links

Mature sequence stu-miR7983-5p

Accession MIMAT0031183
Sequence

1 - 

uaaagucuuuagcgacauugguuc

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR7983-3p

Accession MIMAT0030851
Sequence

37 - 

acuaaugccgguaaagacuuuaac

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).