Stem-loop sequence stu-MIR7980a

AccessionMI0025756 (change log)
DescriptionSolanum tuberosum miR7980a stem-loop
Literature search

1 open access papers mention stu-MIR7980a
(2 sentences)

Stem-loop
   -- ug     ac               au 
5'   u  gacau  gauuuuaucucguga  u
     |  |||||  |||||||||||||||  g
3'   g  uugua  cugaaguagaguacu  a
   ca gu     -a               aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138453.1: 161895-161952 [-]
intergenic
Database links

Mature sequence stu-miR7980a

Accession MIMAT0030847
Sequence

35 - 

augagaugaagucaauguuuggac

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).