Stem-loop sequence hsa-mir-7973-2

AccessionMI0025749 (change log)
Symbol HGNC:MIR7973-2
DescriptionHomo sapiens miR-7973-2 stem-loop
Gene family MIPF0001693; mir-7973
Stem-loop
   --                       c c    aaaacc 
5'   ugugacccuagaauaauuacuca c ucuc      g
     ||||||||||||||||||||||| | ||||       
3'   acacugggaucuuauuaaugggu g agag      a
   ac                       u c    acucag 
Get sequence
Deep sequencing
13 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 51314032-51314107 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-7973-2
hsa-mir-7973-1chr15: 51314034-51314109 [+]
hsa-mir-7973-2chr15: 51314032-51314107 [-]
Database links

Mature sequence hsa-miR-7973

Accession MIMAT0031176
Sequence

1 - 

ugugacccuagaauaauuac

 - 20

Get sequence
Deep sequencing11 reads, 8 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23660593 "Research resource: small RNA-seq of human granulosa cells reveals miRNAs in FSHR and aromatase genes" Velthut-Meikas A, Simm J, Tuuri T, Tapanainen JS, Metsis M, Salumets A Mol Endocrinol. 27:1128-1141(2013).