Stem-loop sequence bta-mir-7864

AccessionMI0025544 (change log)
DescriptionBos taurus miR-7864 stem-loop
Stem-loop
   -    ug   uu     u       c    c 
5'  cugc  acu  gaagg ggaagca ggug u
    ||||  |||  ||||| ||||||| ||||  
3'  gacg  ugg  cuucu ccuucgu cuac a
   a    gu   -c     -       -    a 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr29: 45671693-45671752 [-]
intergenic
Database links

Mature sequence bta-miR-7864

Accession MIMAT0030449
Sequence

40 - 

cuuccucuuccgguuggcaga

 - 60

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23472090 "Next generation sequencing reveals the expression of a unique miRNA profile in response to a gram-positive bacterial infection" Lawless N, Foroushani AB, McCabe MS, O'Farrelly C, Lynn DJ PLoS One. 8:e57543(2013).