Stem-loop sequence bta-mir-2285ae

AccessionMI0025543 (change log)
DescriptionBos taurus miR-2285ae stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285ae
(15 sentences)

Stem-loop
   ---         a                 g 
5'    agaaaguuc uuuagguuuuucuauag a
      ||||||||| |||||||||||||||||  
3'    uuuuucagg aaguucaaaaagguguc u
   cgg         c                 g 
Get sequence
Deep sequencing
187 reads, 0 reads per million, 46 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr8: 74016989-74017049 [+]
sense
ENSBTAT00000020616 ; DOCK5-201; intron 20
Database links

Mature sequence bta-miR-2285ae

Accession MIMAT0030448
Sequence

1 - 

agaaaguucauuuagguuuuuc

 - 22

Get sequence
Deep sequencing59 reads, 32 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23472090 "Next generation sequencing reveals the expression of a unique miRNA profile in response to a gram-positive bacterial infection" Lawless N, Foroushani AB, McCabe MS, O'Farrelly C, Lynn DJ PLoS One. 8:e57543(2013).