Stem-loop sequence bta-mir-2285ad

AccessionMI0025541 (change log)
DescriptionBos taurus miR-2285ad stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285ad
(15 sentences)

Stem-loop
   ---            ca      ccauaa 
5'    aaaaguucguuu  guuuuu      c
      ||||||||||||  ||||||      a
3'    uuuucaaguaaa  caaaag      u
   ggu            cc      acauuu 
Get sequence
Deep sequencing
157 reads, 0 reads per million, 46 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr23: 32466258-32466315 [+]
intergenic
Database links

Mature sequence bta-miR-2285ad

Accession MIMAT0030446
Sequence

37 - 

aaaacccaaaugaacuuuuugg

 - 58

Get sequence
Deep sequencing145 reads, 42 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23472090 "Next generation sequencing reveals the expression of a unique miRNA profile in response to a gram-positive bacterial infection" Lawless N, Foroushani AB, McCabe MS, O'Farrelly C, Lynn DJ PLoS One. 8:e57543(2013).