Stem-loop sequence bta-mir-7863

AccessionMI0025540 (change log)
DescriptionBos taurus miR-7863 stem-loop
Stem-loop
   --a        ca       ------a   u 
5'    uggacugu  ccugagg       gcc a
      ||||||||  |||||||       ||| a
3'    accugaca  ggacucc       cgg u
   aaa        ac       cugacaa   a 
Get sequence
Deep sequencing
14 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr8: 103534757-103534813 [+]
intergenic
Database links

Mature sequence bta-miR-7863

Accession MIMAT0030445
Sequence

1 - 

auggacugucaccugaggagc

 - 21

Get sequence
Deep sequencing14 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23472090 "Next generation sequencing reveals the expression of a unique miRNA profile in response to a gram-positive bacterial infection" Lawless N, Foroushani AB, McCabe MS, O'Farrelly C, Lynn DJ PLoS One. 8:e57543(2013).