Stem-loop sequence bta-mir-7862

AccessionMI0025537 (change log)
DescriptionBos taurus miR-7862 stem-loop
Stem-loop
   -ca           ga        - --u     
5'    cagcuccaggg  cgccguuc c   gucc 
      |||||||||||  |||||||| |   ||| u
3'    gucgagguccc  guggugag g   cagg 
   cga           uc        u uau     
Get sequence
Deep sequencing
48 reads, 0 reads per million, 22 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr9: 61750313-61750375 [-]
sense
ENSBTAT00000046162 ; ANKRD6-201; intron 5
ENSBTAT00000065624 ; ANKRD6-202; intron 9
Database links

Mature sequence bta-miR-7862

Accession MIMAT0030442
Sequence

43 - 

uggugcucccuggagcugagc

 - 63

Get sequence
Deep sequencing6 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23472090 "Next generation sequencing reveals the expression of a unique miRNA profile in response to a gram-positive bacterial infection" Lawless N, Foroushani AB, McCabe MS, O'Farrelly C, Lynn DJ PLoS One. 8:e57543(2013).