Stem-loop sequence bta-mir-7861

AccessionMI0025536 (change log)
DescriptionBos taurus miR-7861 stem-loop
Stem-loop
   ---ca         aaa    g  c    ugg 
5'      cacucagau   guag ca uuuu   u
        |||||||||   |||| || ||||    
3'      gugagucug   cauc gu aaag   u
   aguga         auc    -  -    uuc 
Get sequence
Deep sequencing
454 reads, 0 reads per million, 64 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr13: 13169246-13169306 [-]
intergenic
Database links

Mature sequence bta-miR-7861

Accession MIMAT0030441
Sequence

39 - 

ugcuaccuagucugagugaguga

 - 61

Get sequence
Deep sequencing115 reads, 50 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23472090 "Next generation sequencing reveals the expression of a unique miRNA profile in response to a gram-positive bacterial infection" Lawless N, Foroushani AB, McCabe MS, O'Farrelly C, Lynn DJ PLoS One. 8:e57543(2013).