Stem-loop sequence bta-mir-2285ac

AccessionMI0025535 (change log)
DescriptionBos taurus miR-2285ac stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285ac
(15 sentences)

Stem-loop
   --         g  ug        c  aag 
5'   agaaaguuu uu  gguuuuuc gu   a
     ||||||||| ||  |||||||| ||    
3'   uuuuucaga aa  ccaaaagg ca   u
   gg         g  gu        a  aug 
Get sequence
Deep sequencing
2099 reads, 6.25 reads per million, 64 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr11: 4530677-4530736 [-]
sense
ENSBTAT00000061518 ; REV1-201; intron 8
Database links

Mature sequence bta-miR-2285ac

Accession MIMAT0030440
Sequence

39 - 

aaaaccugaagagacuuuuugg

 - 60

Get sequence
Deep sequencing50 reads, 19 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23472090 "Next generation sequencing reveals the expression of a unique miRNA profile in response to a gram-positive bacterial infection" Lawless N, Foroushani AB, McCabe MS, O'Farrelly C, Lynn DJ PLoS One. 8:e57543(2013).