Stem-loop sequence bta-mir-7860

AccessionMI0025534 (change log)
DescriptionBos taurus miR-7860 stem-loop
Stem-loop
   - a                   ggagg  g  g 
5'  c cucugugcagccgcuccag     ca ca u
    | |||||||||||||||||||     || ||  
3'  g gagacacgucggcgagguc     gu gu u
   u c                   ----a  g  g 
Get sequence
Deep sequencing
146 reads, 0 reads per million, 24 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr12: 15689560-15689622 [+]
sense
ENSBTAT00000023803 ; COG3-201; intron 1
Database links

Mature sequence bta-miR-7860

Accession MIMAT0030439
Sequence

43 - 

uggagcggcugcacagagcgu

 - 63

Get sequence
Deep sequencing118 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23472090 "Next generation sequencing reveals the expression of a unique miRNA profile in response to a gram-positive bacterial infection" Lawless N, Foroushani AB, McCabe MS, O'Farrelly C, Lynn DJ PLoS One. 8:e57543(2013).