Stem-loop sequence bta-mir-2285ab

AccessionMI0025531 (change log)
DescriptionBos taurus miR-2285ab stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285ab
(15 sentences)

Stem-loop
   ---ga     ug   u   c      uaag 
5'      aaguu  uuc ggu uuucua    a
        |||||  ||| ||| ||||||     
3'      uucaa  aag cca aaaggu    u
   gguuc     gu   u   a      uugc 
Get sequence
Deep sequencing
6602 reads, 163 reads per million, 73 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr12: 51244631-51244689 [+]
intergenic
Database links

Mature sequence bta-miR-2285ab

Accession MIMAT0030436
Sequence

38 - 

aaaaccugaaugaacuucuugg

 - 59

Get sequence
Deep sequencing6513 reads, 77 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23472090 "Next generation sequencing reveals the expression of a unique miRNA profile in response to a gram-positive bacterial infection" Lawless N, Foroushani AB, McCabe MS, O'Farrelly C, Lynn DJ PLoS One. 8:e57543(2013).