Stem-loop sequence bta-mir-2285aa

AccessionMI0025530 (change log)
DescriptionBos taurus miR-2285aa stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285aa
(15 sentences)

Stem-loop
   --ca          -    a      ca   g 
5'     aaaaguucgu ccag uuuuuc  uaa a
       |||||||||| |||| ||||||  |||  
3'     uuuucaagca gguc aaaaag  auu u
   cggg          a    -      ac   g 
Get sequence
Deep sequencing
1797 reads, 7.14 reads per million, 70 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr2: 5210613-5210674 [+]
sense
ENSBTAT00000027687 ; ERCC3-201; intron 12
Database links

Mature sequence bta-miR-2285aa

Accession MIMAT0030435
Sequence

40 - 

aaaacuggaacgaacuuuugggc

 - 62

Get sequence
Deep sequencing714 reads, 69 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23472090 "Next generation sequencing reveals the expression of a unique miRNA profile in response to a gram-positive bacterial infection" Lawless N, Foroushani AB, McCabe MS, O'Farrelly C, Lynn DJ PLoS One. 8:e57543(2013).