Stem-loop sequence bta-mir-7857-1

AccessionMI0025527 (change log)
DescriptionBos taurus miR-7857-1 stem-loop
Gene family MIPF0002001; mir-7857
Literature search

1 open access papers mention bta-mir-7857-1
(1 sentences)

Stem-loop
   --au      -        g  u   cgug    a 
5'     agccag uuggggaa aa gcc    ucuu a
       |||||| |||||||| || |||    |||| a
3'     ucgguc aaccucuu uu ugg    agag g
   uuuc      c        g  -   ---a    u 
Get sequence
Deep sequencing
510 reads, 0 reads per million, 58 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr23: 30973815-30973880 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-7857-1
bta-mir-7857-1chr23: 30973815-30973880 [+]
bta-mir-7857-2chr23: 30983593-30983679 [-]
Database links

Mature sequence bta-miR-7857-5p

Accession MIMAT0030432
Sequence

1 - 

auagccaguuggggaagaaugc

 - 22

Get sequence
Deep sequencing486 reads, 50 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23472090 "Next generation sequencing reveals the expression of a unique miRNA profile in response to a gram-positive bacterial infection" Lawless N, Foroushani AB, McCabe MS, O'Farrelly C, Lynn DJ PLoS One. 8:e57543(2013).