Stem-loop sequence rno-mir-155

AccessionMI0025509 (change log)
DescriptionRattus norvegicus miR-155 stem-loop
Gene family MIPF0000157; mir-155
Literature search

81 open access papers mention rno-mir-155
(444 sentences)

Stem-loop
                 ugu a        uu gcc 
5' cuguuaaugcuaau   g uagggguu  g   u
   ||||||||||||||   | ||||||||  |    
3' gacaauuacgauug   c auccucag  c   c
                 --u c        -u agu 
Get sequence
Deep sequencing
20070 reads, 0.833 reads per million, 480 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr11: 24176603-24176667 [+]
intergenic
Database links

Mature sequence rno-miR-155-5p

Accession MIMAT0030409
Sequence

4 - 

uuaaugcuaauugugauaggggu

 - 26

Get sequence
Deep sequencing19977 reads, 480 experiments
Evidence not experimental
Predicted targets

Mature sequence rno-miR-155-3p

Accession MIMAT0030410
Sequence

43 - 

cuccuaccuguuagcauuaac

 - 63

Get sequence
Deep sequencing90 reads, 66 experiments
Evidence not experimental
Predicted targets

References

1
PMID:23329697 "Rat mir-155 generated from the lncRNA Bic is 'hidden' in the alternate genomic assembly and reveals the existence of novel mammalian miRNAs and clusters" Uva P, Da Sacco L, Del Corno M, Baldassarre A, Sestili P, Orsini M, Palma A, Gessani S, Masotti A RNA. 19:365-379(2013).