Stem-loop sequence hhi-mir-181b

AccessionMI0025431 (change log)
DescriptionHippoglossus hippoglossus miR-181b stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   ---ag    c   cacucucaaa       auaaa         cu           uaca 
5'      gagg guu          ggcugca     cauucauug  gucgguggguu    u
        |||| |||          |||||||     |||||||||  |||||||||||    a
3'      cucc caa          uuggcgu     guaaguaac  uagucacucaa    a
   aauga    a   --------ac       cagac         --           uaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hhi-miR-181b

Accession MIMAT0030353
Sequence

31 - 

aacauucauugcugucgguggguu

 - 54

Get sequence
Evidence experimental; SOLiD [1]

References

1