Stem-loop sequence ama-MIR396

AccessionMI0025287 (change log)
DescriptionAvicennia marina miR396 stem-loop
Gene family MIPF0000047; MIR396
Literature search

1 open access papers mention ama-MIR396
(4 sentences)

Stem-loop
   gcua                 a     u  --aac    uuu    a 
5'     uuccacagcuuucuuga cuuuc ug     ugcu   uaua u
       ||||||||||||||||| ||||| ||     ||||   |||| u
3'     agggugucgaaagaacu gaagg ac     acga   augu u
   caaa                 c     u  auacc    uau    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ama-miR396-5p

Accession MIMAT0031154
Sequence

5 - 

uuccacagcuuucuugaacuu

 - 25

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ama-miR396-3p

Accession MIMAT0031155
Sequence

71 - 

aagcucaagaaagcuguggga

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1