Stem-loop sequence oar-mir-99a

AccessionMI0025285 (change log)
DescriptionOvis aries miR-99a stem-loop
Gene family MIPF0000033; mir-10
Literature search

3 open access papers mention oar-mir-99a
(6 sentences)

Stem-loop
   cc          a         uc   u      g  aag 
5'   cauuggcaua acccguaga  cga cuugug ug   u
     |||||||||| |||||||||  ||| |||||| ||    
3'   gugacugugu uggguaucu  gcu gaacac gc   g
   gu          c         uc   c      -  cag 
Get sequence
Deep sequencing
142236 reads, 2.46e+04 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr1: 138652383-138652463 [-]
intergenic
Clustered miRNAs
< 10kb from oar-mir-99a
oar-mir-99achr1: 138652383-138652463 [-]
oar-let-7cchr1: 138651622-138651705 [-]
Database links

Mature sequence oar-miR-99a

Accession MIMAT0030064
Sequence

13 - 

aacccguagauccgaucuug

 - 32

Get sequence
Deep sequencing135505 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).