Stem-loop sequence oar-mir-374b

AccessionMI0025284 (change log)
DescriptionOvis aries miR-374b stem-loop
Gene family MIPF0000288; mir-374
Literature search

2 open access papers mention oar-mir-374b
(2 sentences)

Stem-loop
   gaa  aau  ---u  u    ug au             c       c 
5'    ga   cc    ac cgga  g  auaauacaaccug uaagugu c
      ||   ||    || ||||  |  ||||||||||||| |||||||  
3'    cu   gg    ug gccu  u  uauuauguuggac auucacg u
   cug  cuc  uauc  u    gu ac             u       a 
Get sequence
Deep sequencing
18012 reads, 3.41e+03 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chrX: 62796657-62796751 [-]
intergenic
Database links

Mature sequence oar-miR-374b

Accession MIMAT0030063
Sequence

22 - 

auauaauacaaccugcuaagu

 - 42

Get sequence
Deep sequencing17884 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).