Stem-loop sequence oar-mir-374a

AccessionMI0025283 (change log)
DescriptionOvis aries miR-374a stem-loop
Gene family MIPF0000288; mir-374
Literature search

1 open access papers mention oar-mir-374a
(1 sentences)

Stem-loop
        c   c                        u 
5' uacau ggc auuauaauacaaccugauaagugu a
   ||||| ||| ||||||||||||||||||||||||  
3' augug cug uaauguuauguuggacuauucacg c
        u   u                        a 
Get sequence
Deep sequencing
2161 reads, 338 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chrX: 62860382-62860453 [-]
intergenic
Database links

Mature sequence oar-miR-374a

Accession MIMAT0030062
Sequence

12 - 

uuauaauacaaccugauaagug

 - 33

Get sequence
Deep sequencing2030 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).