Stem-loop sequence oar-mir-106a

AccessionMI0025282 (change log)
DescriptionOvis aries miR-106a stem-loop
Gene family MIPF0000001; mir-17
Literature search

1 open access papers mention oar-mir-106a
(1 sentences)

Stem-loop
     u   cc      -        a  g     g   c  u 
5' cc ugg  auguaa aagugcuu ca ugcag uag uu u
   || |||  |||||| |||||||| || ||||| ||| || u
3' gg acc  uacauu uucacgaa gu acguc auc ag g
     u   au      c        c  a     -   u  a 
Get sequence
Deep sequencing
53421 reads, 1.01e+04 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chrX: 95476711-95476791 [+]
intergenic
Database links

Mature sequence oar-miR-106a

Accession MIMAT0030061
Sequence

13 - 

aaaagugcuuacagugcaggu

 - 33

Get sequence
Deep sequencing53292 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).