Stem-loop sequence oar-mir-30c

AccessionMI0025279 (change log)
DescriptionOvis aries miR-30c stem-loop
Gene family MIPF0000005; mir-30
Literature search

2 open access papers mention oar-mir-30c
(4 sentences)

Stem-loop
   ca   u  -aa     cc    ugu u       u   aca        ug gag 
5'   gac gu   ccaug  guag   g guaaaca ccu   cucucagc  u   c
     ||| ||   |||||  ||||   | ||||||| |||   ||||||||  |   u
3'   cug ca   gguac  cguc   c cauuugu ggg   gagggucg  g   c
   --   -  aaa     --    uuc u       u   --a        gu gag 
Get sequence
Deep sequencing
137994 reads, 2.78e+04 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr1: 15038299-15038403 [+]
sense
ENSOART00000022100 ; NFYC-201; intron 5
Database links

Mature sequence oar-miR-30c

Accession MIMAT0030058
Sequence

26 - 

uguaaacauccuacacucuca

 - 46

Get sequence
Deep sequencing137951 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).